algorithms graphpad prism 10 1 2 graphpad software (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
algorithms graphpad prism 10 1 2 graphpad software
Algorithms Graphpad Prism 10 1 2 Graphpad Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+graphpad+prism+10+1+2+graphpad+software/PRRX2-pBLSK+(Plasmid+%2321012)/pm40449480-254-235-230
Average 93 stars, based on 13 article reviews
Algorithms Graphpad Prism 10 1 2 Graphpad Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+graphpad+prism+10+1+2+graphpad+software/PRRX2-pBLSK+(Plasmid+%2321012)/pm40449480-254-235-230
Average 93 stars, based on 13 article reviews
algorithms graphpad prism 10 1 2 graphpad software - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
cDNA Synthesis:Article Title: Combined therapy with DR5-targeting antibody-drug conjugate and CDK inhibitors as a strategy for advanced colorectal cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BeyoClick TM EdU Cell Proliferation Kit with Alexa Fluor 555 Beyotime Cat#C0075S Annexin V-FITC Apoptosis Detection Kit Beyotime Cat#C1062L Cell Cycle and Apoptosis Analysis Kit Beyotime Cat#C1052 UltraSensitiveTM SP(mouse/rabbit)IHC Kit MXB Biotechnologies Cat#KIT-9730 TransZol Up TransGen Biotech Cat#ET111 EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransGen Biotech Cat#AE311 PerfectStart® Green qPCR SuperMix TransGen Biotech Cat#AQ602 Colorectal Cancer Organoid Kit BioGenous Technologies Cat#K2103-CR Tumor Tissue Digestion Solution BioGenous Technologies Cat#K601003 Cancer Organoid Basal Medium BioGenous Technologies Cat#B213152 Organoid Culture ECM BioGenous Technologies Cat#M315066 Organoid Dissociation Solution BioGenous Technologies Cat#E238001 Deposited data PDX RNAseq This paper GEO: GSE288560 Cell line RNAseq This paper GEO: GSE289746 Whole Exome Sequencing This paper SRA: PRJNA1218401 Proteome sequencing This paper JPST003783 Experimental models: Cell lines Human:HCT116 iCell Bioscience Inc. iCell-h071 Human:P53R iCell Bioscience Inc. iCell-h169 Human:RKO iCell Bioscience Inc. iCell-h252 Human:COLO205 iCell Bioscience Inc. iCell-h045 Human:HEK293T iCell Bioscience Inc. iCell-h237 Experimental models: Organisms/strains Mouse: NOD/SCID mice females Cyagen Biosciences Inc N/A Mouse: NOD/SCID mice females Jiangsu Huachuang sino Pharma Tech Co.,Ltd N/A Oligonucleotides shCDK4#2 targeted sequence: 5 ′ -GTTCTTCTGCAGTCCACATAT-3 ′ Sangon Biotech N/A shCDK4#3 targeted sequence: 5 ′ -ACAGTTCGTGAGGTGGCTTTA-3 ′ Sangon Biotech N/A CDK4-forward: TGGTGTTTGAGCATGTAGACC Sangon Biotech N/A CDK4-reverse: GATCCTTGATCGTTTCGGCTG Sangon Biotech N/A Actin-forward: GCCAACACAGTGCTGTCTGG Sangon Biotech N/A Actin-reverse: TCAGGAGGAGCAATGATCTTG Sangon Biotech N/A Recombinant DNA pLKO.1 This paper N/A plasmids pMD2.G This Real-time Polymerase Chain Reaction:Article Title: Combined therapy with DR5-targeting antibody-drug conjugate and CDK inhibitors as a strategy for advanced colorectal cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BeyoClick TM EdU Cell Proliferation Kit with Alexa Fluor 555 Beyotime Cat#C0075S Annexin V-FITC Apoptosis Detection Kit Beyotime Cat#C1062L Cell Cycle and Apoptosis Analysis Kit Beyotime Cat#C1052 UltraSensitiveTM SP(mouse/rabbit)IHC Kit MXB Biotechnologies Cat#KIT-9730 TransZol Up TransGen Biotech Cat#ET111 EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransGen Biotech Cat#AE311 PerfectStart® Green qPCR SuperMix TransGen Biotech Cat#AQ602 Colorectal Cancer Organoid Kit BioGenous Technologies Cat#K2103-CR Tumor Tissue Digestion Solution BioGenous Technologies Cat#K601003 Cancer Organoid Basal Medium BioGenous Technologies Cat#B213152 Organoid Culture ECM BioGenous Technologies Cat#M315066 Organoid Dissociation Solution BioGenous Technologies Cat#E238001 Deposited data PDX RNAseq This paper GEO: GSE288560 Cell line RNAseq This paper GEO: GSE289746 Whole Exome Sequencing This paper SRA: PRJNA1218401 Proteome sequencing This paper JPST003783 Experimental models: Cell lines Human:HCT116 iCell Bioscience Inc. iCell-h071 Human:P53R iCell Bioscience Inc. iCell-h169 Human:RKO iCell Bioscience Inc. iCell-h252 Human:COLO205 iCell Bioscience Inc. iCell-h045 Human:HEK293T iCell Bioscience Inc. iCell-h237 Experimental models: Organisms/strains Mouse: NOD/SCID mice females Cyagen Biosciences Inc N/A Mouse: NOD/SCID mice females Jiangsu Huachuang sino Pharma Tech Co.,Ltd N/A Oligonucleotides shCDK4#2 targeted sequence: 5 ′ -GTTCTTCTGCAGTCCACATAT-3 ′ Sangon Biotech N/A shCDK4#3 targeted sequence: 5 ′ -ACAGTTCGTGAGGTGGCTTTA-3 ′ Sangon Biotech N/A CDK4-forward: TGGTGTTTGAGCATGTAGACC Sangon Biotech N/A CDK4-reverse: GATCCTTGATCGTTTCGGCTG Sangon Biotech N/A Actin-forward: GCCAACACAGTGCTGTCTGG Sangon Biotech N/A Actin-reverse: TCAGGAGGAGCAATGATCTTG Sangon Biotech N/A Recombinant DNA pLKO.1 This paper N/A plasmids pMD2.G This Sequencing:Article Title: Combined therapy with DR5-targeting antibody-drug conjugate and CDK inhibitors as a strategy for advanced colorectal cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BeyoClick TM EdU Cell Proliferation Kit with Alexa Fluor 555 Beyotime Cat#C0075S Annexin V-FITC Apoptosis Detection Kit Beyotime Cat#C1062L Cell Cycle and Apoptosis Analysis Kit Beyotime Cat#C1052 UltraSensitiveTM SP(mouse/rabbit)IHC Kit MXB Biotechnologies Cat#KIT-9730 TransZol Up TransGen Biotech Cat#ET111 EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransGen Biotech Cat#AE311 PerfectStart® Green qPCR SuperMix TransGen Biotech Cat#AQ602 Colorectal Cancer Organoid Kit BioGenous Technologies Cat#K2103-CR Tumor Tissue Digestion Solution BioGenous Technologies Cat#K601003 Cancer Organoid Basal Medium BioGenous Technologies Cat#B213152 Organoid Culture ECM BioGenous Technologies Cat#M315066 Organoid Dissociation Solution BioGenous Technologies Cat#E238001 Deposited data PDX RNAseq This paper GEO: GSE288560 Cell line RNAseq This paper GEO: GSE289746 Whole Exome Sequencing This paper SRA: PRJNA1218401 Proteome sequencing This paper JPST003783 Experimental models: Cell lines Human:HCT116 iCell Bioscience Inc. iCell-h071 Human:P53R iCell Bioscience Inc. iCell-h169 Human:RKO iCell Bioscience Inc. iCell-h252 Human:COLO205 iCell Bioscience Inc. iCell-h045 Human:HEK293T iCell Bioscience Inc. iCell-h237 Experimental models: Organisms/strains Mouse: NOD/SCID mice females Cyagen Biosciences Inc N/A Mouse: NOD/SCID mice females Jiangsu Huachuang sino Pharma Tech Co.,Ltd N/A Oligonucleotides shCDK4#2 targeted sequence: 5 ′ -GTTCTTCTGCAGTCCACATAT-3 ′ Sangon Biotech N/A shCDK4#3 targeted sequence: 5 ′ -ACAGTTCGTGAGGTGGCTTTA-3 ′ Sangon Biotech N/A CDK4-forward: TGGTGTTTGAGCATGTAGACC Sangon Biotech N/A CDK4-reverse: GATCCTTGATCGTTTCGGCTG Sangon Biotech N/A Actin-forward: GCCAACACAGTGCTGTCTGG Sangon Biotech N/A Actin-reverse: TCAGGAGGAGCAATGATCTTG Sangon Biotech N/A Recombinant DNA pLKO.1 This paper N/A plasmids pMD2.G This Recombinant:Article Title: Combined therapy with DR5-targeting antibody-drug conjugate and CDK inhibitors as a strategy for advanced colorectal cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BeyoClick TM EdU Cell Proliferation Kit with Alexa Fluor 555 Beyotime Cat#C0075S Annexin V-FITC Apoptosis Detection Kit Beyotime Cat#C1062L Cell Cycle and Apoptosis Analysis Kit Beyotime Cat#C1052 UltraSensitiveTM SP(mouse/rabbit)IHC Kit MXB Biotechnologies Cat#KIT-9730 TransZol Up TransGen Biotech Cat#ET111 EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransGen Biotech Cat#AE311 PerfectStart® Green qPCR SuperMix TransGen Biotech Cat#AQ602 Colorectal Cancer Organoid Kit BioGenous Technologies Cat#K2103-CR Tumor Tissue Digestion Solution BioGenous Technologies Cat#K601003 Cancer Organoid Basal Medium BioGenous Technologies Cat#B213152 Organoid Culture ECM BioGenous Technologies Cat#M315066 Organoid Dissociation Solution BioGenous Technologies Cat#E238001 Deposited data PDX RNAseq This paper GEO: GSE288560 Cell line RNAseq This paper GEO: GSE289746 Whole Exome Sequencing This paper SRA: PRJNA1218401 Proteome sequencing This paper JPST003783 Experimental models: Cell lines Human:HCT116 iCell Bioscience Inc. iCell-h071 Human:P53R iCell Bioscience Inc. iCell-h169 Human:RKO iCell Bioscience Inc. iCell-h252 Human:COLO205 iCell Bioscience Inc. iCell-h045 Human:HEK293T iCell Bioscience Inc. iCell-h237 Experimental models: Organisms/strains Mouse: NOD/SCID mice females Cyagen Biosciences Inc N/A Mouse: NOD/SCID mice females Jiangsu Huachuang sino Pharma Tech Co.,Ltd N/A Oligonucleotides shCDK4#2 targeted sequence: 5 ′ -GTTCTTCTGCAGTCCACATAT-3 ′ Sangon Biotech N/A shCDK4#3 targeted sequence: 5 ′ -ACAGTTCGTGAGGTGGCTTTA-3 ′ Sangon Biotech N/A CDK4-forward: TGGTGTTTGAGCATGTAGACC Sangon Biotech N/A CDK4-reverse: GATCCTTGATCGTTTCGGCTG Sangon Biotech N/A Actin-forward: GCCAACACAGTGCTGTCTGG Sangon Biotech N/A Actin-reverse: TCAGGAGGAGCAATGATCTTG Sangon Biotech N/A Recombinant DNA pLKO.1 This paper N/A plasmids pMD2.G This Plasmid Preparation:Article Title: Combined therapy with DR5-targeting antibody-drug conjugate and CDK inhibitors as a strategy for advanced colorectal cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BeyoClick TM EdU Cell Proliferation Kit with Alexa Fluor 555 Beyotime Cat#C0075S Annexin V-FITC Apoptosis Detection Kit Beyotime Cat#C1062L Cell Cycle and Apoptosis Analysis Kit Beyotime Cat#C1052 UltraSensitiveTM SP(mouse/rabbit)IHC Kit MXB Biotechnologies Cat#KIT-9730 TransZol Up TransGen Biotech Cat#ET111 EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransGen Biotech Cat#AE311 PerfectStart® Green qPCR SuperMix TransGen Biotech Cat#AQ602 Colorectal Cancer Organoid Kit BioGenous Technologies Cat#K2103-CR Tumor Tissue Digestion Solution BioGenous Technologies Cat#K601003 Cancer Organoid Basal Medium BioGenous Technologies Cat#B213152 Organoid Culture ECM BioGenous Technologies Cat#M315066 Organoid Dissociation Solution BioGenous Technologies Cat#E238001 Deposited data PDX RNAseq This paper GEO: GSE288560 Cell line RNAseq This paper GEO: GSE289746 Whole Exome Sequencing This paper SRA: PRJNA1218401 Proteome sequencing This paper JPST003783 Experimental models: Cell lines Human:HCT116 iCell Bioscience Inc. iCell-h071 Human:P53R iCell Bioscience Inc. iCell-h169 Human:RKO iCell Bioscience Inc. iCell-h252 Human:COLO205 iCell Bioscience Inc. iCell-h045 Human:HEK293T iCell Bioscience Inc. iCell-h237 Experimental models: Organisms/strains Mouse: NOD/SCID mice females Cyagen Biosciences Inc N/A Mouse: NOD/SCID mice females Jiangsu Huachuang sino Pharma Tech Co.,Ltd N/A Oligonucleotides shCDK4#2 targeted sequence: 5 ′ -GTTCTTCTGCAGTCCACATAT-3 ′ Sangon Biotech N/A shCDK4#3 targeted sequence: 5 ′ -ACAGTTCGTGAGGTGGCTTTA-3 ′ Sangon Biotech N/A CDK4-forward: TGGTGTTTGAGCATGTAGACC Sangon Biotech N/A CDK4-reverse: GATCCTTGATCGTTTCGGCTG Sangon Biotech N/A Actin-forward: GCCAACACAGTGCTGTCTGG Sangon Biotech N/A Actin-reverse: TCAGGAGGAGCAATGATCTTG Sangon Biotech N/A Recombinant DNA pLKO.1 This paper N/A plasmids pMD2.G This Software:Article Title: Combined therapy with DR5-targeting antibody-drug conjugate and CDK inhibitors as a strategy for advanced colorectal cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BeyoClick TM EdU Cell Proliferation Kit with Alexa Fluor 555 Beyotime Cat#C0075S Annexin V-FITC Apoptosis Detection Kit Beyotime Cat#C1062L Cell Cycle and Apoptosis Analysis Kit Beyotime Cat#C1052 UltraSensitiveTM SP(mouse/rabbit)IHC Kit MXB Biotechnologies Cat#KIT-9730 TransZol Up TransGen Biotech Cat#ET111 EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransGen Biotech Cat#AE311 PerfectStart® Green qPCR SuperMix TransGen Biotech Cat#AQ602 Colorectal Cancer Organoid Kit BioGenous Technologies Cat#K2103-CR Tumor Tissue Digestion Solution BioGenous Technologies Cat#K601003 Cancer Organoid Basal Medium BioGenous Technologies Cat#B213152 Organoid Culture ECM BioGenous Technologies Cat#M315066 Organoid Dissociation Solution BioGenous Technologies Cat#E238001 Deposited data PDX RNAseq This paper GEO: GSE288560 Cell line RNAseq This paper GEO: GSE289746 Whole Exome Sequencing This paper SRA: PRJNA1218401 Proteome sequencing This paper JPST003783 Experimental models: Cell lines Human:HCT116 iCell Bioscience Inc. iCell-h071 Human:P53R iCell Bioscience Inc. iCell-h169 Human:RKO iCell Bioscience Inc. iCell-h252 Human:COLO205 iCell Bioscience Inc. iCell-h045 Human:HEK293T iCell Bioscience Inc. iCell-h237 Experimental models: Organisms/strains Mouse: NOD/SCID mice females Cyagen Biosciences Inc N/A Mouse: NOD/SCID mice females Jiangsu Huachuang sino Pharma Tech Co.,Ltd N/A Oligonucleotides shCDK4#2 targeted sequence: 5 ′ -GTTCTTCTGCAGTCCACATAT-3 ′ Sangon Biotech N/A shCDK4#3 targeted sequence: 5 ′ -ACAGTTCGTGAGGTGGCTTTA-3 ′ Sangon Biotech N/A CDK4-forward: TGGTGTTTGAGCATGTAGACC Sangon Biotech N/A CDK4-reverse: GATCCTTGATCGTTTCGGCTG Sangon Biotech N/A Actin-forward: GCCAACACAGTGCTGTCTGG Sangon Biotech N/A Actin-reverse: TCAGGAGGAGCAATGATCTTG Sangon Biotech N/A Recombinant DNA pLKO.1 This paper N/A plasmids pMD2.G This |